Online Inquiry
STYK1 Knockout Cell Line
SPL-03543
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | STYK1 |
| Gene Abbr. | STYK1 |
| Gene ID | 55359 |
| Full Name | serine/threonine/tyrosine kinase 1 |
| Alias | NOK, SuRTK106 |
| Species | Human |
| Genomic Locus | chr12:10631280 |
| Transcript | NM_018423 |
| WT Expression Level | 5.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Receptor protein tyrosine kinases, like STYK1, play important roles in diverse cellular and developmental processes, such as cell proliferation, differentiation, and survival (Liu et al., 2004 [PubMed 15150103]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of STYK1. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCCCTAGGTGGAGGAACAG |
| PCR Primer |
Forward: AGTGTTCATATTGGCTCGAAAGATG Reverse: AATTTGTTTCAGGGTCTGCTTTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.