STRADA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

STRADA cDNA ORF Clone, Human, untagged

STRADA cDNA ORF Clone, Human, untagged

SPD-14208

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human STE20-related kinase adaptor alpha
Target Information
Species Human
Target Name STRADA
Gene Abbr. STRADA
Gene ID 92335
Full Name STE20 related adaptor alpha
Alias LYK5, NY-BR-96, PMSE, STRAD, STRAD alpha
Product Details
Description Full length Clone DNA of Human STE20-related kinase adaptor alpha
NCBI Ref Seq NM_001003786.2
RefSeq ORF Size 1185 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.19kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.