Online Inquiry
STK39 Knockout Cell Line
SPL-03536
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | STK39 |
| Gene Abbr. | STK39 |
| Gene ID | 27347 |
| Full Name | serine/threonine kinase 39 |
| Alias | DCHT, PASK, SPAK |
| Species | Human |
| Genomic Locus | chr2:168181980 |
| Transcript | NM_013233 |
| WT Expression Level | 15.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of STK39. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATAGTTCATCCATACTGGTC |
| PCR Primer |
Forward: CAAAACTGGAGATAACACCTTGCTC Reverse: CCATTTGATCGCTGATGTTGTTTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.