Online Inquiry
STK38 Knockout Cell Line
SPL-03533
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | STK38 |
| Gene Abbr. | STK38 |
| Gene ID | 11329 |
| Full Name | serine/threonine kinase 38 |
| Alias | NDR, NDR1 |
| Species | Human |
| Genomic Locus | chr6:36540082 |
| Transcript | NM_007271 |
| WT Expression Level | 29.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of STK38. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTCTTCATGTTGAGCGATA |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTGGGTTAATGGCAGGGACTTT Reverse: GTGCCTCCAACTTCCCATAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.