STK3 Knockout Cell Line - CD BioSciences

service-banner

STK3 Knockout Cell Line

STK3 Knockout Cell Line

SPL-03529

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name MST2
Gene Abbr. STK3
Gene ID 6788
Full Name serine/threonine kinase 3
Alias KRS1, MST2
Species Human
Genomic Locus chr8:98749332
Transcript NM_006281
WT Expression Level 12.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of STK3.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence TACAGACCTCTGGATTGTTA
PCR Primer Forward: TGTGTAACAAAATACCAACTAGTCAGA
Reverse: TTATGCATAGTTGGTGAACTCCAGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.