Online Inquiry
STK26 Knockout Cell Line
SPL-03526
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | STK26 |
| Gene Abbr. | STK26 |
| Gene ID | 51765 |
| Full Name | serine/threonine kinase 26 |
| Alias | MASK, MST4 |
| Species | Human |
| Genomic Locus | chrX:132023626 |
| Transcript | NM_001042453 |
| Introduction | The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of MST4. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTGGACAGCCACCGGCGAG |
| PCR Primer |
Forward: GATCGAAAAGCCTGGGAGGG Reverse: TCACCTGGCCATAGTGACCG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.