Stk11 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Stk11 cDNA ORF Clone, Mouse, untagged

Stk11 cDNA ORF Clone, Mouse, untagged

SPD-09789

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse serine/threonine kinase 11.
Target Information
Species Mouse
Target Name LKB1
Gene Abbr. Stk11
Gene ID 20869
Full Name serine/threonine kinase 11
Alias AA408040, Lkb, Lkb1, Pa, Par-4
Introduction LKB1 (STK11) is a serine/threonine kinase and tumor suppressor that helps control cell structure, apoptosis and energy homeostasis through regulation of numerous downstream kinases. A cytosolic protein complex comprised of LKB1, putative kinase STRAD, and the MO25 scaffold protein, activates both AMP-activated protein kinase (AMPK) and several AMPK-related kinases. AMPK plays a predominant role as the master regulator of cellular energy homeostasis, controlling downstream effectors that regulate cell growth and apoptosis in response to cellular ATP concentrations. LKB1 appears to be phosphorylated in cells at several sites, including human LKB1 at Ser31/325/428 and Thr189/336/363.Mutation in the corresponding LKB1 gene causes Peutz-Jeghers syndrome (PJS), an autosomal dominant disorder characterized by benign GI tract polyps and dark skin lesions of the mouth, hands, and feet. A variety of other LKB1 gene mutations have been associated with the formation of sporadic cancers in several tissues.
Product Details
Description Full length Clone DNA of Mouse serine/threonine kinase 11.
NCBI Ref Seq NM_011492.3
RefSeq ORF Size 1311 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.