Online Inquiry
Stk11 cDNA ORF Clone, Mouse, untagged
SPD-09789
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse serine/threonine kinase 11. |
Target Information | |
---|---|
Species | Mouse |
Target Name | LKB1 |
Gene Abbr. | Stk11 |
Gene ID | 20869 |
Full Name | serine/threonine kinase 11 |
Alias | AA408040, Lkb, Lkb1, Pa, Par-4 |
Introduction | LKB1 (STK11) is a serine/threonine kinase and tumor suppressor that helps control cell structure, apoptosis and energy homeostasis through regulation of numerous downstream kinases. A cytosolic protein complex comprised of LKB1, putative kinase STRAD, and the MO25 scaffold protein, activates both AMP-activated protein kinase (AMPK) and several AMPK-related kinases. AMPK plays a predominant role as the master regulator of cellular energy homeostasis, controlling downstream effectors that regulate cell growth and apoptosis in response to cellular ATP concentrations. LKB1 appears to be phosphorylated in cells at several sites, including human LKB1 at Ser31/325/428 and Thr189/336/363.Mutation in the corresponding LKB1 gene causes Peutz-Jeghers syndrome (PJS), an autosomal dominant disorder characterized by benign GI tract polyps and dark skin lesions of the mouth, hands, and feet. A variety of other LKB1 gene mutations have been associated with the formation of sporadic cancers in several tissues. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse serine/threonine kinase 11. |
NCBI Ref Seq | NM_011492.3 |
RefSeq ORF Size | 1311 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.