STK11 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

STK11 cDNA ORF Clone, Human, C-FLAG tag

STK11 cDNA ORF Clone, Human, C-FLAG tag

SPD-09790

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human serine/threonine kinase 11 with C terminal Flag tag.
Target Information
Species Human
Target Name LKB1
Gene Abbr. STK11
Gene ID 6794
Full Name serine/threonine kinase 11
Alias LKB1, PJS, hLKB1
Introduction LKB1 (STK11) is a serine/threonine kinase and tumor suppressor that helps control cell structure, apoptosis and energy homeostasis through regulation of numerous downstream kinases. A cytosolic protein complex comprised of LKB1, putative kinase STRAD, and the MO25 scaffold protein, activates both AMP-activated protein kinase (AMPK) and several AMPK-related kinases. AMPK plays a predominant role as the master regulator of cellular energy homeostasis, controlling downstream effectors that regulate cell growth and apoptosis in response to cellular ATP concentrations. LKB1 appears to be phosphorylated in cells at several sites, including human LKB1 at Ser31/325/428 and Thr189/336/363.Mutation in the corresponding LKB1 gene causes Peutz-Jeghers syndrome (PJS), an autosomal dominant disorder characterized by benign GI tract polyps and dark skin lesions of the mouth, hands, and feet. A variety of other LKB1 gene mutations have been associated with the formation of sporadic cancers in several tissues.
Product Details
Description Full length Clone DNA of Human serine/threonine kinase 11 with C terminal Flag tag.
NCBI Ref Seq NM_000455.4
RefSeq ORF Size 1302 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.34kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.