STK10 Knockout Cell Line - CD BioSciences

service-banner

STK10 Knockout Cell Line

STK10 Knockout Cell Line

SPL-03520

Size Price
1 Unit Online Inquiry
Description
241bp insertion
Target Information
Target Name STK10
Gene Abbr. STK10
Gene ID 6793
Full Name serine/threonine kinase 10
Alias LOK, PRO2729
Species Human
Genomic Locus chr5:172156692
Transcript NM_005990
WT Expression Level 7.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. The protein can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. The kinase can also negatively regulate interleukin 2 expression in T-cells via the mitogen activated protein kinase kinase 1 pathway. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 241bp insertion in a coding exon of STK10.
Description 241bp insertion
Parental Cell Line C631
Guide RNA Sequence CATCGTGGAGATTGAGATCC
PCR Primer Forward: ATGCTGAGAAAGAGCTGAAGACT
Reverse: GTTAAGAACAATGTACGTTCCGGTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.