Online Inquiry
STK10 Knockout Cell Line
SPL-03519
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | STK10 |
| Gene Abbr. | STK10 |
| Gene ID | 6793 |
| Full Name | serine/threonine kinase 10 |
| Alias | LOK, PRO2729 |
| Species | Human |
| Genomic Locus | chr5:172156692 |
| Transcript | NM_005990 |
| WT Expression Level | 7.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. The protein can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. The kinase can also negatively regulate interleukin 2 expression in T-cells via the mitogen activated protein kinase kinase 1 pathway. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of STK10. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATCGTGGAGATTGAGATCC |
| PCR Primer |
Forward: ATGCTGAGAAAGAGCTGAAGACT Reverse: GTTAAGAACAATGTACGTTCCGGTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.