Stat5b cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Stat5b cDNA ORF Clone, Mouse, C-HA tag

Stat5b cDNA ORF Clone, Mouse, C-HA tag

SPD-14161

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5B with C terminal HA tag.
Target Information
Species Mouse
Target Name Stat5
Gene Abbr. Stat5b
Gene ID 20851
Full Name signal transducer and activator of transcription 5B
Introduction Stat5 is activated in response to a wide variety of ligands including IL-2, GM-CSF, growth hormone and prolactin. Phosphorylation at Tyr694 is obligatory for Stat5 activation. This phosphorylation is mediated by Src upon erythropoietin stimulation. Stat5 is constitutively active in some leukemic cell types. Phosphorylated Stat5 is found in some endothelial cells treated with IL-3, which suggests its involvement in angiogenesis and cell motility. Stat5a and Stat5b are independently regulated and activated in various cell types. For instance, interferon treatment predominantly activates Stat5a in U-937 cells and Stat5b in HeLa cells.
Product Details
Description Full length Clone DNA of Mouse signal transducer and activator of transcription 5B with C terminal HA tag.
NCBI Ref Seq NM_001113563.1
RefSeq ORF Size 2361 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.