Online Inquiry
STAT3 cDNA ORF Clone, Human, N-Myc tag
SPD-14134
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human signal transducer and activator of transcription 3 (acute-phase response factor), transcript variant 1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Stat3 |
Gene Abbr. | STAT3 |
Gene ID | 6774 |
Full Name | signal transducer and activator of transcription 3 |
Alias | ADMIO, ADMIO1, APRF, HIES |
Introduction | The Stat3 transcription factor is an important signaling molecule for many cytokines and growth factor receptors and is required for murine fetal development. Research studies have shown that Stat3 is constitutively activated in a number of human tumors and possesses oncogenic potential and anti-apoptotic activities. Stat3 is activated by phosphorylation at Tyr705, which induces dimerization, nuclear translocation, and DNA binding. Transcriptional activation seems to be regulated by phosphorylation at Ser727 through the MAPK or mTOR pathways. Stat3 isoform expression appears to reflect biological function as the relative expression levels of Stat3α (86 kDa) and Stat3β (79 kDa) depend on cell type, ligand exposure, or cell maturation stage. It is notable that Stat3β lacks the serine phosphorylation site within the carboxy-terminal transcriptional activation domain.In addition to phosphorylation, Stat3 can be modified by acetylation. Stat3 is acetylated at Lys685 by p300/CREB-binding protein (CBP) which can stimulate DNA binding and transactivation activity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human signal transducer and activator of transcription 3 (acute-phase response factor), transcript variant 1 with N terminal Myc tag. |
NCBI Ref Seq | NM_139276.2 |
RefSeq ORF Size | 2358 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | HindIII + NotI (6kb + 2.36kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.