STAT3 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

STAT3 cDNA ORF Clone, Human, C-HA tag

STAT3 cDNA ORF Clone, Human, C-HA tag

SPD-14130

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human signal transducer and activator of transcription 3 (acute-phase response factor), transcript variant 1 with C terminal HA tag.
Target Information
Species Human
Target Name Stat3
Gene Abbr. STAT3
Gene ID 6774
Full Name signal transducer and activator of transcription 3
Alias ADMIO, ADMIO1, APRF, HIES
Introduction The Stat3 transcription factor is an important signaling molecule for many cytokines and growth factor receptors and is required for murine fetal development. Research studies have shown that Stat3 is constitutively activated in a number of human tumors and possesses oncogenic potential and anti-apoptotic activities. Stat3 is activated by phosphorylation at Tyr705, which induces dimerization, nuclear translocation, and DNA binding. Transcriptional activation seems to be regulated by phosphorylation at Ser727 through the MAPK or mTOR pathways. Stat3 isoform expression appears to reflect biological function as the relative expression levels of Stat3α (86 kDa) and Stat3β (79 kDa) depend on cell type, ligand exposure, or cell maturation stage. It is notable that Stat3β lacks the serine phosphorylation site within the carboxy-terminal transcriptional activation domain.In addition to phosphorylation, Stat3 can be modified by acetylation. Stat3 is acetylated at Lys685 by p300/CREB-binding protein (CBP) which can stimulate DNA binding and transactivation activity.
Product Details
Description Full length Clone DNA of Human signal transducer and activator of transcription 3 (acute-phase response factor), transcript variant 1 with C terminal HA tag.
NCBI Ref Seq NM_139276.2
RefSeq ORF Size 2355 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + NotI (6kb + 2.36kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.