Online Inquiry
STAT2 Knockout Cell Line
SPL-03515
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | STAT2 |
| Gene Abbr. | STAT2 |
| Gene ID | 6773 |
| Full Name | signal transducer and activator of transcription 2 |
| Alias | IMD44, ISGF-3, P113, PTORCH3, STAT113 |
| Species | Human |
| Genomic Locus | chr12:56356143 |
| Transcript | NM_005419 |
| WT Expression Level | 21.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of STAT2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAATTTGCGGAAATTCTGCC |
| PCR Primer |
Forward: GTATATGCAACCCTTCTCTCTGCTA Reverse: CTAATACTTCTTATTCCTGGTGCCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.