Online Inquiry
Stat1 cDNA ORF Clone, Mouse, C-His tag
SPD-14087
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse signal transducer and activator of transcription 1 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Stat1 |
Gene Abbr. | Stat1 |
Gene ID | 20846 |
Full Name | signal transducer and activator of transcription 1 |
Alias | 2010005J02Rik, AA408197 |
Introduction | The Stat1 transcription factor is activated in response to a large number of ligands and is essential for responsiveness to IFN-α and IFN-γ. Phosphorylation of Stat1 at Tyr701 induces Stat1 dimerization, nuclear translocation, and DNA binding. Stat1 protein exists as a pair of isoforms, Stat1α (91 kDa) and the splice variant Stat1β (84 kDa). In most cells, both isoforms are activated by IFN-α, but only Stat1α is activated by IFN-γ. The inappropriate activation of Stat1 occurs in many tumors. In addition to tyrosine phosphorylation, Stat1 is also phosphorylated at Ser727 through a p38 mitogen-activated protein kinase (MAPK)-dependent pathway in response to IFN-α and other cellular stresses. Serine phosphorylation may be required for the maximal induction of Stat1-mediated gene activation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse signal transducer and activator of transcription 1 with C terminal His tag. |
NCBI Ref Seq | NM_009283.4 |
RefSeq ORF Size | 2250 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.