STAT1 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

STAT1 cDNA ORF Clone, Human, C-His tag

STAT1 cDNA ORF Clone, Human, C-His tag

SPD-14097

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human signal transducer and activator of transcription 1 with C terminal His tag.
Target Information
Species Human
Target Name Stat1
Gene Abbr. STAT1
Gene ID 6772
Full Name signal transducer and activator of transcription 1
Alias CANDF7, IMD31A, IMD31B, IMD31C, ISGF-3
Introduction The Stat1 transcription factor is activated in response to a large number of ligands and is essential for responsiveness to IFN-α and IFN-γ. Phosphorylation of Stat1 at Tyr701 induces Stat1 dimerization, nuclear translocation, and DNA binding. Stat1 protein exists as a pair of isoforms, Stat1α (91 kDa) and the splice variant Stat1β (84 kDa). In most cells, both isoforms are activated by IFN-α, but only Stat1α is activated by IFN-γ. The inappropriate activation of Stat1 occurs in many tumors. In addition to tyrosine phosphorylation, Stat1 is also phosphorylated at Ser727 through a p38 mitogen-activated protein kinase (MAPK)-dependent pathway in response to IFN-α and other cellular stresses. Serine phosphorylation may be required for the maximal induction of Stat1-mediated gene activation.
Product Details
Description Full length Clone DNA of Human signal transducer and activator of transcription 1 with C terminal His tag.
NCBI Ref Seq NM_007315.3
RefSeq ORF Size 2250 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + NotI (6kb + 2.25kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.