Online Inquiry
STAMBP Knockout Cell Line
SPL-03508
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | STAMBP |
| Gene Abbr. | STAMBP |
| Gene ID | 10617 |
| Full Name | STAM binding protein |
| Alias | AMSH, MICCAP |
| Species | Human |
| Genomic Locus | chr2:73830876 |
| Transcript | NM_201647 |
| WT Expression Level | 24.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Cytokine-mediated signal transduction in the JAK-STAT cascade requires the involvement of adaptor molecules. One such signal-transducing adaptor molecule contains an SH3 domain that is required for induction of MYC and cell growth. The protein encoded by this gene binds to the SH3 domain of the signal-transducing adaptor molecule, and plays a critical role in cytokine-mediated signaling for MYC induction and cell cycle progression. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of STAMBP. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGAGCCTCCCGCCCGAAGAC |
| PCR Primer |
Forward: CCACAGCATTTGGTATGTTTCTCTT Reverse: AGAGTAAATGGATGCCATTCGGATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.