Online Inquiry
SRPK1 Knockout Cell Line
SPL-03481
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | SRPK1 |
| Gene Abbr. | SRPK1 |
| Gene ID | 6732 |
| Full Name | SRSF protein kinase 1 |
| Alias | SFRSK1 |
| Species | Human |
| Genomic Locus | chr6:35888856 |
| Transcript | NM_003137 |
| WT Expression Level | 99.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of SRPK1. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATGTGATCCGAAAGTTAGGC |
| PCR Primer |
Forward: CAGTGGAAACTCAGACAAACACATT Reverse: TCTTACCATTGTTTCTCATCCTGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.