Src cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Src cDNA ORF Clone, Mouse, C-FLAG tag

Src cDNA ORF Clone, Mouse, C-FLAG tag

SPD-14044

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Rous sarcoma oncogene transcript variant 1 with C terminal Flag tag.
Target Information
Species Mouse
Target Name Src
Gene Abbr. Src
Gene ID 20779
Full Name Rous sarcoma oncogene
Alias AW259666, pp60c, pp60c-src
Introduction The Src family of protein tyrosine kinases, which includes Src, Lyn, Fyn, Yes, Lck, Blk, and Hck, are important in the regulation of growth and differentiation of eukaryotic cells. Src activity is regulated by tyrosine phosphorylation at two sites, but with opposing effects. While phosphorylation at Tyr416 in the activation loop of the kinase domain upregulates enzyme activity, phosphorylation at Tyr527 in the carboxy-terminal tail by Csk renders the enzyme less active.
Product Details
Description Full length Clone DNA of Mouse Rous sarcoma oncogene transcript variant 1 with C terminal Flag tag.
NCBI Ref Seq NM_009271.3
RefSeq ORF Size 1665 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.67kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.