Online Inquiry
SRC cDNA ORF Clone, Human, N-Myc tag
SPD-14061
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Src |
| Gene Abbr. | SRC |
| Gene ID | 6714 |
| Full Name | SRC proto-oncogene, non-receptor tyrosine kinase |
| Alias | ASV, SRC1, THC6, c-SRC, p60-Src |
| Introduction | The Src family of protein tyrosine kinases, which includes Src, Lyn, Fyn, Yes, Lck, Blk, and Hck, are important in the regulation of growth and differentiation of eukaryotic cells. Src activity is regulated by tyrosine phosphorylation at two sites, but with opposing effects. While phosphorylation at Tyr416 in the activation loop of the kinase domain upregulates enzyme activity, phosphorylation at Tyr527 in the carboxy-terminal tail by Csk renders the enzyme less active. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal Myc tag. |
| NCBI Ref Seq | NM_005417.3 |
| RefSeq ORF Size | 1611 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.