SQLE Knockout Cell Line - CD BioSciences

service-banner

SQLE Knockout Cell Line

SQLE Knockout Cell Line

SPL-03469

Size Price
1 Unit Online Inquiry
Description
22bp deletion
Target Information
Target Name SQLE
Gene Abbr. SQLE
Gene ID 6713
Full Name squalene epoxidase
Species Human
Genomic Locus chr8:124999545
Transcript NM_003129
WT Expression Level 92.63 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SQLE.
Description 22bp deletion
Parental Cell Line C631
Guide RNA Sequence CACCGAAACGGGGGTCTCCT
PCR Primer Forward: CTCATTTTGGGGAGAACCTTAAACC
Reverse: CGAGCTGCTCCTTATTTTCTGATTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.