Online Inquiry
SPRED2 Knockout Cell Line
SPL-03464
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | SPRED2 |
| Gene Abbr. | SPRED2 |
| Gene ID | 200734 |
| Full Name | sprouty related EVH1 domain containing 2 |
| Alias | Spred-2 |
| Species | Human |
| Genomic Locus | chr2:65344774 |
| Transcript | NM_181784 |
| WT Expression Level | 18.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | SPRED2 is a member of the Sprouty (see SPRY1; MIM 602465)/SPRED family of proteins that regulate growth factor-induced activation of the MAP kinase cascade (see MAPK1; MIM 176948) (Nonami et al., 2004 [PubMed 15465815]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SPRED2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGTAAGGTCATGCACCCCGA |
| PCR Primer |
Forward: GGAAAGGACAGTCACGTTTTACAAT Reverse: TTCTTCTTGTCGTTTTAGTGACAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.