SPARC Knockout Cell Line - CD BioSciences

service-banner

SPARC Knockout Cell Line

SPARC Knockout Cell Line

SPL-03457

Size Price
1 Unit Online Inquiry
Description
20bp deletion
Target Information
Target Name SPARC
Gene Abbr. SPARC
Gene ID 6678
Full Name secreted protein acidic and cysteine rich
Alias BM-40, OI17, ON, ONT
Species Human
Genomic Locus chr5:151673192
Transcript NM_003118
WT Expression Level 18.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of SPARC.
Description 20bp deletion
Parental Cell Line C631
Guide RNA Sequence TGTGGGAGCTAATCCTGTCC
PCR Primer Forward: CACAGTTTCCCACTTGTTAAGTCAA
Reverse: GATTAAATCTGGATTCCCAACCCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.