Online Inquiry
SP3 Knockout Cell Line
SPL-03450
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | SP3 |
| Gene Abbr. | SP3 |
| Gene ID | 6670 |
| Full Name | Sp3 transcription factor |
| Alias | SPR2 |
| Species | Human |
| Genomic Locus | chr2:173956184 |
| Transcript | NM_001017371 |
| WT Expression Level | 27.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to a family of Sp1 related genes that encode transcription factors that regulate transcription by binding to consensus GC- and GT-box regulatory elements in target genes. This protein contains a zinc finger DNA-binding domain and several transactivation domains, and has been reported to function as a bifunctional transcription factor that either stimulates or represses the transcription of numerous genes. Transcript variants encoding different isoforms have been described for this gene, and one has been reported to initiate translation from a non-AUG (AUA) start codon. Additional isoforms, resulting from the use of alternate downstream translation initiation sites, have also been noted. A related pseudogene has been identified on chromosome 13. [provided by RefSeq, Feb 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SP3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGAGCACCAAACCGATGGG |
| PCR Primer |
Forward: CCATTTGATGAATCTGATCCTGGTG Reverse: CTGCTCCTGTATTTGAACTCCATTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.