SP140 Knockout Cell Line - CD BioSciences

service-banner

SP140 Knockout Cell Line

SP140 Knockout Cell Line

SPL-03448

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name SP140
Gene Abbr. SP140
Gene ID 11262
Full Name SP140 nuclear body protein
Alias LYSP100, LYSP100-A, LYSP100-B
Species Human
Genomic Locus chr2:230237224
Transcript NM_007237
WT Expression Level 0.06 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of SP140.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence AGATGAAGGAGCGGTCTCGG
PCR Primer Forward: AGTGTCTACTTCCACGTTGTATCTT
Reverse: TCCCCCAACATTTACTACAGAAGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.