Online Inquiry
SP110 Knockout Cell Line
SPL-03446
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | SP110 |
| Gene Abbr. | SP110 |
| Gene ID | 3431 |
| Full Name | SP110 nuclear body protein |
| Alias | IFI41, IFI75, IPR1, VODI |
| Species | Human |
| Genomic Locus | chr2:230214980 |
| Transcript | NM_004510 |
| WT Expression Level | 7.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The nuclear body is a multiprotein complex that may have a role in the regulation of gene transcription. This gene is a member of the SP100/SP140 family of nuclear body proteins and encodes a leukocyte-specific nuclear body component. The protein can function as an activator of gene transcription and may serve as a nuclear hormone receptor coactivator. In addition, it has been suggested that the protein may play a role in ribosome biogenesis and in the induction of myeloid cell differentiation. Alternative splicing has been observed for this gene and three transcript variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of SP110. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGCGTGAATATCCCAATC |
| PCR Primer |
Forward: CATCTTAGAGAGTTGGGATCAGCTT Reverse: TCTCTGGAAGCCTGTAGAAATTTGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.