Online Inquiry
SP100 Knockout Cell Line
SPL-03444
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | SP100 |
| Gene Abbr. | SP100 |
| Gene ID | 6672 |
| Full Name | SP100 nuclear antigen |
| Alias | lysp100b |
| Species | Human |
| Genomic Locus | chr2:230443063 |
| Transcript | NM_001206702 |
| WT Expression Level | 2.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a subnuclear organelle and major component of the PML (promyelocytic leukemia)-SP100 nuclear bodies. PML and SP100 are covalently modified by the SUMO-1 modifier, which is considered crucial to nuclear body interactions. The encoded protein binds heterochromatin proteins and is thought to play a role in tumorigenesis, immunity, and gene regulation. Alternatively spliced variants have been identified for this gene; one of which encodes a high-mobility group protein. [provided by RefSeq, Aug 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of SP100. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGATGAGATCACGATCACGG |
| PCR Primer |
Forward: ATGTAAACTCTTACAGCCTCCACAA Reverse: CACTCATAGGAGACCTGTCAGTTAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.