SP100 Knockout Cell Line - CD BioSciences

service-banner

SP100 Knockout Cell Line

SP100 Knockout Cell Line

SPL-03444

Size Price
1 Unit Online Inquiry
Description
20bp deletion
Target Information
Target Name SP100
Gene Abbr. SP100
Gene ID 6672
Full Name SP100 nuclear antigen
Alias lysp100b
Species Human
Genomic Locus chr2:230443063
Transcript NM_001206702
WT Expression Level 2.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a subnuclear organelle and major component of the PML (promyelocytic leukemia)-SP100 nuclear bodies. PML and SP100 are covalently modified by the SUMO-1 modifier, which is considered crucial to nuclear body interactions. The encoded protein binds heterochromatin proteins and is thought to play a role in tumorigenesis, immunity, and gene regulation. Alternatively spliced variants have been identified for this gene; one of which encodes a high-mobility group protein. [provided by RefSeq, Aug 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of SP100.
Description 20bp deletion
Parental Cell Line C631
Guide RNA Sequence TGATGAGATCACGATCACGG
PCR Primer Forward: ATGTAAACTCTTACAGCCTCCACAA
Reverse: CACTCATAGGAGACCTGTCAGTTAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.