SOCS6 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

SOCS6 cDNA ORF Clone, Human, C-Myc tag

SOCS6 cDNA ORF Clone, Human, C-Myc tag

SPD-14026

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 6 with C terminal Myc tag.
Target Information
Species Human
Target Name SOCS6
Gene Abbr. SOCS6
Gene ID 9306
Full Name suppressor of cytokine signaling 6
Alias CIS-4, CIS4, HSPC060, SOCS-4, SOCS-6
Introduction The protein encoded by this gene contains a SH2 domain and a CIS homolog domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by GM-CSF and EPO in hematopoietic cells. A high expression level of this gene was found in factor-independent chronic myelogenous leukemia (CML) and erythroleukemia (HEL) cell lines. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 6 with C terminal Myc tag.
NCBI Ref Seq NM_004232.3
RefSeq ORF Size 1608 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.