Online Inquiry
SOCS5 cDNA ORF Clone, Human, C-His tag
SPD-14015
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human suppressor of cytokine signaling 5 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SOCS5 |
| Gene Abbr. | SOCS5 |
| Gene ID | 9655 |
| Full Name | suppressor of cytokine signaling 5 |
| Alias | CIS6, CISH6, Cish5, SOCS-5 |
| Introduction | The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human suppressor of cytokine signaling 5 with C terminal His tag. |
| NCBI Ref Seq | NM_014011.4 |
| RefSeq ORF Size | 1656 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 1.66kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.