SOCS5 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

SOCS5 cDNA ORF Clone, Human, C-FLAG tag

SOCS5 cDNA ORF Clone, Human, C-FLAG tag

SPD-14014

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 5 with C terminal Flag tag.
Target Information
Species Human
Target Name SOCS5
Gene Abbr. SOCS5
Gene ID 9655
Full Name suppressor of cytokine signaling 5
Alias CIS6, CISH6, Cish5, SOCS-5
Introduction The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported.
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 5 with C terminal Flag tag.
NCBI Ref Seq NM_014011.4
RefSeq ORF Size 1650 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.65kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.