SOCS4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SOCS4 cDNA ORF Clone, Human, untagged

SOCS4 cDNA ORF Clone, Human, untagged

SPD-14013

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 4.
Target Information
Species Human
Target Name SOCS4
Gene Abbr. SOCS4
Gene ID 122809
Full Name suppressor of cytokine signaling 4
Alias SOCS7
Introduction The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 4.
NCBI Ref Seq NM_080867.2
RefSeq ORF Size 1323 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.