Online Inquiry
SOCS4 cDNA ORF Clone, Human, N-FLAG tag
SPD-14009
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human suppressor of cytokine signaling 4 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SOCS4 |
Gene Abbr. | SOCS4 |
Gene ID | 122809 |
Full Name | suppressor of cytokine signaling 4 |
Alias | SOCS7 |
Introduction | The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human suppressor of cytokine signaling 4 with N terminal Flag tag. |
NCBI Ref Seq | NM_080867.2 |
RefSeq ORF Size | 1323 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.