Online Inquiry
SOCS3 cDNA ORF Clone, Human, untagged
SPD-14003
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human suppressor of cytokine signaling 3. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SOCS3 |
| Gene Abbr. | SOCS3 |
| Gene ID | 9021 |
| Full Name | suppressor of cytokine signaling 3 |
| Alias | ATOD4, CIS3, Cish3, SOCS-3, SSI-3 |
| Introduction | The suppressor of cytokine signaling (SOCS) family members are negative regulators of cytokine signal transduction that inhibit the Jak/Stat pathway. The SOCS family consists of at least 8 members including the originally identified cytokine-inducible SH2-containing protein (CIS1), as well as SOCS1-7. Each SOCS family member contains a central SH2 domain and a conserved carboxy-terminal motif designated as the SOCS box. These proteins are important regulators of cytokine signaling, proliferation, differentiation, and immune responses.Low levels of SOCS3 are observed in lung, spleen, and thymus and, like other SOCS family members, its expression is rapidly induced by a number of factors including interleukins, EPO, IFN-γ, CSF, and TNF-α. SOCS3 uses its SH2 domain to bind activated Jaks and their cognate receptors to provide negative feedback inhibition. In addition to the initially described inducers of SOCS3 expression, subsequent studies have described SOCS3-mediated negative feedback inhibition for leptin GH chemokine receptors insulin and certain pathogens. SOCS3 deletion results in embryonic lethality with placental insufficiency. SOCS3 signaling has been linked pathologically to allergic responses inflammatory disease endotoxic shock wound repair and obesity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human suppressor of cytokine signaling 3. |
| NCBI Ref Seq | NM_003955.3 |
| RefSeq ORF Size | 677 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 0.68kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.