SOCS3 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

SOCS3 cDNA ORF Clone, Human, N-His tag

SOCS3 cDNA ORF Clone, Human, N-His tag

SPD-14000

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 3 with N terminal His tag.
Target Information
Species Human
Target Name SOCS3
Gene Abbr. SOCS3
Gene ID 9021
Full Name suppressor of cytokine signaling 3
Alias ATOD4, CIS3, Cish3, SOCS-3, SSI-3
Introduction The suppressor of cytokine signaling (SOCS) family members are negative regulators of cytokine signal transduction that inhibit the Jak/Stat pathway. The SOCS family consists of at least 8 members including the originally identified cytokine-inducible SH2-containing protein (CIS1), as well as SOCS1-7. Each SOCS family member contains a central SH2 domain and a conserved carboxy-terminal motif designated as the SOCS box. These proteins are important regulators of cytokine signaling, proliferation, differentiation, and immune responses.Low levels of SOCS3 are observed in lung, spleen, and thymus and, like other SOCS family members, its expression is rapidly induced by a number of factors including interleukins, EPO, IFN-γ, CSF, and TNF-α. SOCS3 uses its SH2 domain to bind activated Jaks and their cognate receptors to provide negative feedback inhibition. In addition to the initially described inducers of SOCS3 expression, subsequent studies have described SOCS3-mediated negative feedback inhibition for leptin GH chemokine receptors insulin and certain pathogens. SOCS3 deletion results in embryonic lethality with placental insufficiency. SOCS3 signaling has been linked pathologically to allergic responses inflammatory disease endotoxic shock wound repair and obesity.
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 3 with N terminal His tag.
NCBI Ref Seq NM_003955.3
RefSeq ORF Size 677 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.72kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.