Socs2 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Socs2 cDNA ORF Clone, Mouse, N-FLAG tag

Socs2 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-13971

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse suppressor of cytokine signaling 2 with N terminal Flag tag.
Target Information
Species Mouse
Target Name SOCS2
Gene Abbr. Socs2
Gene ID 216233
Full Name suppressor of cytokine signaling 2
Alias 8030460M17, AI527257, AW108012, CI, CIS2
Introduction The suppressor of cytokine signaling (SOCS) family members are negative regulators of cytokine signal transduction that inhibit the Jak/Stat pathway. The SOCS family consists of at least 8 members including the originally identified cytokine-inducible SH2-containing protein (CIS1), as well as SOCS1-7. Each SOCS family member contains a central SH2 domain and a conserved carboxy-terminal motif designated as the SOCS box. These proteins are important regulators of cytokine signaling, proliferation, differentiation, and immune responses.Activity of SOCS2 has been predominantly linked to growth hormone (GH) and insulin-like growth factor 1 (IGF-1) signaling but may also contribute to several biological processes including metabolism, bone formation, neuronal development, cancer, infection and other cytokine-dependent pathways. SOCS2 is widely expressed in adult and fetal tissues and is induced upon cytokine treatment. A number of studies suggest that SOCS2 can have either a positive or negative effect on GH/cytokine signaling. Mice deficient in SOCS2 grow signficantly larger than normal littermates. SOCS2 binds to tyrosine-phosphorylated GH and IGF-1 receptors via its SH2 domain, suppressing their signaling. In addition, the SOCS box of SOCS2 binds to Elongin B and C leading to activity as a ubiquitin ligase, promoting the degradation of the receptors as well as other SOCS family members.
Product Details
Description Full length Clone DNA of Mouse suppressor of cytokine signaling 2 with N terminal Flag tag.
NCBI Ref Seq NM_007706.4
RefSeq ORF Size 597 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.