SOCS1 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

SOCS1 cDNA ORF Clone, Human, C-HA tag

SOCS1 cDNA ORF Clone, Human, C-HA tag

SPD-13959

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 1 with C terminal HA tag.
Target Information
Species Human
Target Name SOCS1
Gene Abbr. SOCS1
Gene ID 8651
Full Name suppressor of cytokine signaling 1
Alias CIS1, CISH1, JAB, SOCS-1, SSI-1
Introduction The suppressor of cytokine signaling (SOCS) family members are negative regulators of cytokine signal transduction that inhibit the Jak/Stat pathway. The SOCS family consists of at least 8 members including the originally identified cytokine-inducible SH2-containing protein (CIS1), as well as SOCS1-7. Each SOCS family member contains a central SH2 domain and a conserved carboxy-terminal motif designated as the SOCS box. These proteins are important regulators of cytokine signaling, proliferation, differentiation, and immune responses.SOCS1 (suppressor of cytokine signaling 1), also known as JAB (Janus Kinase binding protein), SSI-1 (Stat-induced Stat inhibitor-1), and TIP3 (Tec-interacting protein 3), is a cytokine-regulated SOCS family member that directly inhibits Jak family members through interaction within their kinase activation loop. In addition to inhibiting Jak/Stat signaling, SOCS1 can also negatively regulate Toll-like receptors that contribute to innate immunity. The SOCS box of SOCS1 can trigger ubiquitin-mediated degradation of proteins within and outside of the Jak/Stat pathway. The highest expression of SOCS1 is seen in the thymus and spleen and it plays a critical role in T-cell activation and lymphocyte differentiation. SOCS1 also functions as a tumor suppressor protein by inhibiting hematopoietic oncogenes.
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 1 with C terminal HA tag.
NCBI Ref Seq NM_003745.1
RefSeq ORF Size 636 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.