Online Inquiry
SNX9 Knockout Cell Line
SPL-03434
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
31bp deletion |
Target Information | |
---|---|
Target Name | SNX9 |
Gene Abbr. | SNX9 |
Gene ID | 51429 |
Full Name | sorting nexin 9 |
Alias | SDP1, SH3PX1, SH3PXD3A, WISP |
Species | Human |
Genomic Locus | chr6:157896951 |
Transcript | NM_016224 |
WT Expression Level | 14.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of SNX9. |
Description | 31bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GAAGGCAGTGTCCCAGTTGT |
PCR Primer |
Forward: ATTCTCCTTCTTTTTACCCCTCTCA Reverse: TTGCATCCTGTAAATTGAGCTTTGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.