Online Inquiry
SMURF2 cDNA ORF Clone, Human, N-HA tag
SPD-13944
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 2 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SMURF |
Gene Abbr. | SMURF2 |
Gene ID | 64750 |
Full Name | SMAD specific E3 ubiquitin protein ligase 2 |
Introduction | Smad ubiquitin regulatory factor 2 (Smurf2) is a HECT domain E3 ubiquitin ligase. It was initially identified as an inhibitor of TGF-β/BMP signaling by targeting R-Smads and TGF type I receptor for ubiquitination and degradation. Subsequent studies have revealed its role in neuronal and planar cell polarity, as well as in the senescence response and suppression of tumorigenesis. Smurf2 has a broad range of substrates including RUNX2, AMSH, Rap1B, and RNF11.Smurf2 is widely expressed in various tissues. The C2 domain of Smurf2 inhibits its catalytic activity by interacting with the HECT domain. Research studies have shown that Smurf2 functions as a tumor suppressor by maintaining genomic stability through targeting RNF20. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 2 with N terminal HA tag. |
NCBI Ref Seq | NM_022739.3 |
RefSeq ORF Size | 2247 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.