SMURF2 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

SMURF2 cDNA ORF Clone, Human, C-HA tag

SMURF2 cDNA ORF Clone, Human, C-HA tag

SPD-13939

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 2 with C terminal HA tag.
Target Information
Species Human
Target Name SMURF
Gene Abbr. SMURF2
Gene ID 64750
Full Name SMAD specific E3 ubiquitin protein ligase 2
Introduction Smad ubiquitin regulatory factor 2 (Smurf2) is a HECT domain E3 ubiquitin ligase. It was initially identified as an inhibitor of TGF-β/BMP signaling by targeting R-Smads and TGF type I receptor for ubiquitination and degradation. Subsequent studies have revealed its role in neuronal and planar cell polarity, as well as in the senescence response and suppression of tumorigenesis. Smurf2 has a broad range of substrates including RUNX2, AMSH, Rap1B, and RNF11.Smurf2 is widely expressed in various tissues. The C2 domain of Smurf2 inhibits its catalytic activity by interacting with the HECT domain. Research studies have shown that Smurf2 functions as a tumor suppressor by maintaining genomic stability through targeting RNF20.
Product Details
Description Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 2 with C terminal HA tag.
NCBI Ref Seq NM_022739.3
RefSeq ORF Size 2247 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.