Online Inquiry
SMURF1 cDNA ORF Clone, Human, N-His tag
SPD-13932
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SMURF |
Gene Abbr. | SMURF1 |
Gene ID | 57154 |
Full Name | SMAD specific E3 ubiquitin protein ligase 1 |
Introduction | Bone morphogenetic proteins (BMPs) constitute a large family of signaling molecules that regulate a wide range of critical processes including morphogenesis, cell-fate determination, proliferation, differentiation, and apoptosis. BMP receptors are members of the TGF-β family of Ser/Thr kinase receptors. Ligand binding induces multimerization, autophosphorylation, and activation of these receptors. They subsequently phosphorylate Smad1 at Ser463 and Ser465 in the carboxy-terminal motif SSXS, as well as Smad5 and Smad9 (Smad8) at their corresponding sites. These phosphorylated Smads dimerize with the coactivating Smad4 and translocate to the nucleus, where they stimulate transcription of target genes.MAP kinases and CDKs 8 and 9 phosphorylate residues in the linker region of Smad1, including Ser206. The phosphorylation of Ser206 recruits Smurf1 to the linker region and leads to the degradation of Smad1. Phosphorylation of this site also promotes Smad1 transcriptional action by recruiting YAP to the linker region.Smurf1, a member of the HECT family of E3 ubiquitin ligases, selectively interacts with BMP pathway Smad effectors, leading to Smad protein ubiquitination and degradation. In addition, Smurf1 interacts with the inhibitor Smad, Smad7, the bone-specific transcription factor Runx2/Cbfa1, RhoA and MEKK2. Smurf1 negatively regulates osteoblast differentiation and bone formation in vivo. A related protein, Smurf2, acts more promiscuously, interacting with both BMP and TGF-β pathway Smad proteins. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 1 with N terminal His tag. |
NCBI Ref Seq | NM_020429.1 |
RefSeq ORF Size | 2274 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.