SMURF1 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

SMURF1 cDNA ORF Clone, Human, C-His tag

SMURF1 cDNA ORF Clone, Human, C-His tag

SPD-13927

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 1 with C terminal His tag.
Target Information
Species Human
Target Name SMURF
Gene Abbr. SMURF1
Gene ID 57154
Full Name SMAD specific E3 ubiquitin protein ligase 1
Introduction Bone morphogenetic proteins (BMPs) constitute a large family of signaling molecules that regulate a wide range of critical processes including morphogenesis, cell-fate determination, proliferation, differentiation, and apoptosis. BMP receptors are members of the TGF-β family of Ser/Thr kinase receptors. Ligand binding induces multimerization, autophosphorylation, and activation of these receptors. They subsequently phosphorylate Smad1 at Ser463 and Ser465 in the carboxy-terminal motif SSXS, as well as Smad5 and Smad9 (Smad8) at their corresponding sites. These phosphorylated Smads dimerize with the coactivating Smad4 and translocate to the nucleus, where they stimulate transcription of target genes.MAP kinases and CDKs 8 and 9 phosphorylate residues in the linker region of Smad1, including Ser206. The phosphorylation of Ser206 recruits Smurf1 to the linker region and leads to the degradation of Smad1. Phosphorylation of this site also promotes Smad1 transcriptional action by recruiting YAP to the linker region.Smurf1, a member of the HECT family of E3 ubiquitin ligases, selectively interacts with BMP pathway Smad effectors, leading to Smad protein ubiquitination and degradation. In addition, Smurf1 interacts with the inhibitor Smad, Smad7, the bone-specific transcription factor Runx2/Cbfa1, RhoA and MEKK2. Smurf1 negatively regulates osteoblast differentiation and bone formation in vivo. A related protein, Smurf2, acts more promiscuously, interacting with both BMP and TGF-β pathway Smad proteins.
Product Details
Description Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 1 with C terminal His tag.
NCBI Ref Seq NM_020429.1
RefSeq ORF Size 2319 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498C/G not causing the amino acid variation.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 2.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.