Online Inquiry
SMARCD3 Knockout Cell Line
SPL-03424
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | SMARCD3 |
| Gene Abbr. | SMARCD3 |
| Gene ID | 6604 |
| Full Name | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 |
| Alias | BAF60C, CRACD3, Rsc6p |
| Species | Human |
| Genomic Locus | chr7:151242807 |
| Transcript | NM_001003801 |
| WT Expression Level | 17.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of SMARCD3. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCATGTAAGCCTGGGACTCG |
| PCR Primer |
Forward: AAAGTGTTGGAGATATAGAGTCGCA Reverse: CATCTTTTGTACCCTAGGATTGCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.