Online Inquiry
SMARCC1 Knockout Cell Line
SPL-03423
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | SMARCC1 |
| Gene Abbr. | SMARCC1 |
| Gene ID | 6599 |
| Full Name | SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 |
| Alias | BAF155, CRACC1, Rsc8, SRG3, SWI3 |
| Species | Human |
| Genomic Locus | chr3:47772837 |
| Transcript | NM_003074 |
| WT Expression Level | 65.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of SMARCC1. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGGAAGCATGTCACCAACC |
| PCR Primer |
Forward: TTTTAAATTCTACACGCTAGCAGCA Reverse: TTTTGAATGCCTGTCTTTATCTTGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.