SMARCC1 Knockout Cell Line - CD BioSciences

service-banner

SMARCC1 Knockout Cell Line

SMARCC1 Knockout Cell Line

SPL-03422

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name SMARCC1
Gene Abbr. SMARCC1
Gene ID 6599
Full Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1
Alias BAF155, CRACC1, Rsc8, SRG3, SWI3
Species Human
Genomic Locus chr3:47772837
Transcript NM_003074
WT Expression Level 65.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of SMARCC1.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence TGGGAAGCATGTCACCAACC
PCR Primer Forward: TTTTAAATTCTACACGCTAGCAGCA
Reverse: TTTTGAATGCCTGTCTTTATCTTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.