SMARCA2 Knockout Cell Line - CD BioSciences

service-banner

SMARCA2 Knockout Cell Line

SMARCA2 Knockout Cell Line

SPL-03421

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name SMARCA2
Gene Abbr. SMARCA2
Gene ID 6595
Full Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Alias BAF190, BRM, NCBRS, SNF2, SNF2L2
Species Human
Genomic Locus chr9:2029181
Transcript NM_139045
WT Expression Level 14.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of SMARCA2.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence CTCCCATCCTATGCCGACGA
PCR Primer Forward: CTTAGCATTACTCTACTGACTGGCA
Reverse: GTTAACAACAGTAGAAAGGGGGATG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.