Online Inquiry
Smad7 cDNA ORF Clone, Mouse, untagged
SPD-13923
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse SMAD family member 7 |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | SMAD |
| Gene Abbr. | Smad7 |
| Gene ID | 17131 |
| Full Name | SMAD family member 7 |
| Alias | Madh, Madh7 |
| Introduction | Members of the Smad family of signal transduction molecules are components of a critical intracellular pathway that transmits TGF-β signals from the cell surface into the nucleus. Three distinct classes of Smads have been defined: the receptor-regulated Smads (R-Smads), which include Smad1, 2, 3, 5, 8; the common-mediator Smad (co-Smad), Smad4; and the antagonistic or inhibitory Smads (I-Smads), Smad6 and 7. Briefly, activated type I receptors associate with specific R-Smads and phosphorylate them on a conserved SSXS motif at the carboxy-terminus of the proteins. The phosphorylated R-Smad dissociates from the receptor and forms a heteromeric complex with the co-Smad, Smad4, and together the complex moves to the nucleus. Once in the nucleus, Smads can target a variety of DNA binding proteins to regulate transcriptional responses. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse SMAD family member 7 |
| NCBI Ref Seq | NM_001042660.1 |
| RefSeq ORF Size | 1281 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.28kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T27 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.