SMAD5 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

SMAD5 cDNA ORF Clone, Human, N-Myc tag

SMAD5 cDNA ORF Clone, Human, N-Myc tag

SPD-13919

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SMAD family member 5 (SMAD5), transcript variant 3 with N terminal Myc tag.
Target Information
Species Human
Target Name SMAD
Gene Abbr. SMAD5
Gene ID 4090
Full Name SMAD family member 5
Alias DWFC, JV5-1, MADH5
Introduction Members of the Smad family of signal transduction molecules are components of a critical intracellular pathway that transmits TGF-β signals from the cell surface into the nucleus. Three distinct classes of Smads have been defined: the receptor-regulated Smads (R-Smads), which include Smad1, 2, 3, 5, 8; the common-mediator Smad (co-Smad), Smad4; and the antagonistic or inhibitory Smads (I-Smads), Smad6 and 7. Briefly, activated type I receptors associate with specific R-Smads and phosphorylate them on a conserved SSXS motif at the carboxy-terminus of the proteins. The phosphorylated R-Smad dissociates from the receptor and forms a heteromeric complex with the co-Smad, Smad4, and together the complex moves to the nucleus. Once in the nucleus, Smads can target a variety of DNA binding proteins to regulate transcriptional responses.
Product Details
Description Full length Clone DNA of Human SMAD family member 5 (SMAD5), transcript variant 3 with N terminal Myc tag.
NCBI Ref Seq NM_001001420.1
RefSeq ORF Size 1398 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.