Online Inquiry
SMAD4 Knockout Cell Line
SPL-03415
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | SMAD |
Gene Abbr. | SMAD4 |
Gene ID | 4089 |
Full Name | SMAD family member 4 |
Alias | DPC4, JIP, MADH4, MYHRS |
Species | Human |
Genomic Locus | chr18:51048711 |
Transcript | NM_005359 |
WT Expression Level | 52.96 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SMAD4. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATGTGATCTATGCCCGTCTC |
PCR Primer |
Forward: CTGAGCACAGGCCTTGAAATTATAC Reverse: ACAACTCGTTCGTAGTGATATGGAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.