Online Inquiry
Smad3 cDNA ORF Clone, Mouse, untagged
SPD-13881
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse MAD homolog 3 (Drosophila). |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | SMAD |
| Gene Abbr. | Smad3 |
| Gene ID | 17127 |
| Full Name | SMAD family member 3 |
| Alias | AU022421, Madh, Madh3 |
| Introduction | Members of the Smad family of signal transduction molecules are components of a critical intracellular pathway that transmit TGF-β signals from the cell surface into the nucleus. Three distinct classes of Smads have been defined: the receptor-regulated Smads (R-Smads), which include Smad1, 2, 3, 5, and 8; the common-mediator Smad (co-Smad), Smad4; and the antagonistic or inhibitory Smads (I-Smads), Smad6 and 7. Activated type I receptors associate with specific R-Smads and phosphorylate them on a conserved carboxy terminal SSXS motif. The phosphorylated R-Smad dissociates from the receptor and forms a heteromeric complex with the co-Smad (Smad4), allowing translocation of the complex to the nucleus. Once in the nucleus, Smads can target a variety of DNA binding proteins to regulate transcriptional responses.Following stimulation by TGF-β, Smad2 and Smad3 become phosphorylated at their carboxyl termini (Ser465 and 467 on Smad2; Ser423 and 425 on Smad3) by TGF-β Receptor I. Phosphorylated Smad 2/3 can complex with Smad4, translocate to the nucleus and regulate gene expression. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse MAD homolog 3 (Drosophila). |
| NCBI Ref Seq | NM_016769.4 |
| RefSeq ORF Size | 1278 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.28kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.