Online Inquiry
Smad1 cDNA ORF Clone, Mouse, C-Myc tag
SPD-13834
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse MAD homolog 1 (Drosophila) with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | SMAD |
| Gene Abbr. | Smad1 |
| Gene ID | 17125 |
| Full Name | SMAD family member 1 |
| Alias | AI528653, Mad, Mad1, Madh, Madh1 |
| Introduction | Members of the Smad family of signal transduction molecules are components of a critical intracellular pathway that transmit TGF-β signals from the cell surface into the nucleus. Three distinct classes of Smads have been defined: the receptor-regulated Smads (R-Smads), which include Smad1, 2, 3, 5, and 8; the common-mediator Smad (co-Smad), Smad4; and the antagonistic or inhibitory Smads (I-Smads), Smad6 and 7. Activated type I receptors associate with specific R-Smads and phosphorylate them on a conserved carboxy terminal SSXS motif. The phosphorylated R-Smad dissociates from the receptor and forms a heteromeric complex with the co-Smad (Smad4), allowing translocation of the complex to the nucleus. Once in the nucleus, Smads can target a variety of DNA binding proteins to regulate transcriptional responses.Oncogenic Ras antagonizes TGF-beta signaling and inhibits the nuclear accumulation of Smad2 and Smad3, which may be explained through MAP kinase dependent phosphorylation of these Smads.Cell stimulation with EGF leads to phosphorylation of Smad2 at a cluster of serine-proline sites within its linker region, including Ser245, 250, and 255. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse MAD homolog 1 (Drosophila) with C terminal Myc tag. |
| NCBI Ref Seq | NM_008539.3 |
| RefSeq ORF Size | 1398 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 1.44kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.